View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_low_105 (Length: 229)
Name: NF16378_low_105
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_low_105 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 141 - 213
Target Start/End: Complemental strand, 682147 - 682075
Alignment:
| Q |
141 |
tggtcggtcaagagcatctctaacaaagcaattcatattcatcctcatagcagtacaattgctccatctactt |
213 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
682147 |
tggtcagtcaagagcatctctaacaaagcaattcatattcatcctcatagcagtacaattgctccatctactt |
682075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University