View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16378_low_110 (Length: 222)

Name: NF16378_low_110
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16378_low_110
NF16378_low_110
[»] chr4 (2 HSPs)
chr4 (17-98)||(24481254-24481335)
chr4 (165-200)||(24481402-24481437)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 17 - 98
Target Start/End: Original strand, 24481254 - 24481335
Alignment:
17 catagggagcgggtggtggggatttatagatatatggtggagactcataaacatatggagggggtataggtttgtagtagta 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24481254 catagggagcgggtggtggggatttatagatatatggtggagactcataaacatatggagggggtataggtttgtagtagta 24481335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 200
Target Start/End: Original strand, 24481402 - 24481437
Alignment:
165 tttgtagacatattgtggaggaggaggtgattcgta 200  Q
    ||||||||||||||||||||||||||||||||||||    
24481402 tttgtagacatattgtggaggaggaggtgattcgta 24481437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University