View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_low_113 (Length: 219)
Name: NF16378_low_113
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_low_113 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 32 - 201
Target Start/End: Complemental strand, 29456745 - 29456576
Alignment:
| Q |
32 |
atttgtttaaaaaccccttacnnnnnnngaagttaaaaaaccatgttcagatcacttatgtttggtttgggtattattcatgatttatgtgggacacaaa |
131 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29456745 |
atttgtttaaaaaccccttacaaaaaaagaagttaaaaaaccatgttcagatcacttatgtttggtttgggtattattcatgatttatgtgggacacaaa |
29456646 |
T |
|
| Q |
132 |
cttcagaggtctaaccctttcactgcatcatttgttcataacaatttaacttatatttgatgtggcagat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29456645 |
cttcagaggtctaaccctttcactgcatcatttgttcataacaatttaacttatatttgatgtggcagat |
29456576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 61 - 201
Target Start/End: Complemental strand, 29448766 - 29448642
Alignment:
| Q |
61 |
aagttaaaaaaccatgttcagatcacttatgtttggtttgggtattattcatgatttatgtgggacacaaacttcagaggtctaaccctttcactgcatc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
29448766 |
aagttaaaaaaccatgttcagatcacttatatttggtttgggtattattcatgatttacgtgggacacaaa----------------ctttcactgcatc |
29448683 |
T |
|
| Q |
161 |
atttgttcataacaatttaacttatatttgatgtggcagat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29448682 |
atttgttcataacaatttaacttatatttgatgtggcagat |
29448642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University