View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_low_45 (Length: 386)
Name: NF16378_low_45
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 10 - 372
Target Start/End: Original strand, 43789167 - 43789530
Alignment:
| Q |
10 |
cacagatgccgtttgaggtaatggtgccggagttta--acatgctggtgatgtcgtcgggatttttctcgacaaatacattaccaccgatgccgtttgag |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43789167 |
cacagatgacgtttgaggtaatggtgccggagtttataacacgccggt-atgtcgtcgggatttttctcgacaaatacattaccaccgatgccgtttgag |
43789265 |
T |
 |
| Q |
108 |
gtctttcccaccgttacaagcatgcagtcgcagacggtggtatctttcaatgacgtttggcctgggaataacatctctgcaagtccgtcgaattttcttc |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43789266 |
gtctttcccacagttacaagcatgcagtcgcagacggtggtatctttcaatgacgtttggcctgggaataacatctctgcaagtccgtcgaattttcttc |
43789365 |
T |
 |
| Q |
208 |
ccagcgacgttgttccgccgcagatgccaccgaaccagttcagttcttttgatttcgactaagtttatttcttcttgttctttcatacattcattatatt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43789366 |
ccagcgacgttgttccgccgcagatgccaccgaaccagttcagttcttttgatttcgactaagtttatttcttcttgttctttcatacattcattatatt |
43789465 |
T |
 |
| Q |
308 |
ctctttagttatgtttgtgtcgggagaatacaacactcctttagtgggttttcgtatgtgttatg |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43789466 |
ctctttagttatgtttgtgtcgggagaatacaacactcctttagtgggttttcgtatgtgttatg |
43789530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University