View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_low_65 (Length: 320)
Name: NF16378_low_65
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_low_65 |
 |  |
|
| [»] scaffold0352 (2 HSPs) |
 |  |  |
|
| [»] scaffold0237 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0352 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 16403 - 16228
Alignment:
| Q |
1 |
agtcaattgacaccaggtttctttacagtctttgctcaccttttcagctttttcactctattatcacgccttcctaatatcaataattgatttacccnnn |
100 |
Q |
| |
|
|||||||||| | |||||| ||||| | | |||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16403 |
agtcaattgaaaacaggttcctttaaattttttgctcaccctttcatctttttcactctattctcacgccttcctaatatcaataattgatttaccc--t |
16306 |
T |
 |
| Q |
101 |
nnnnnnnngaagaggcataatcgatttacccttattggtgatctattctcactgtagtcaattatttcgaagtttatg |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16305 |
ttttttttgaagaggcataatcgatttacacttattggcgatctattctcaccgtagtcaattatttcgaagtttatg |
16228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 244 - 310
Target Start/End: Complemental strand, 16162 - 16096
Alignment:
| Q |
244 |
accagtggtgctaaaagtctggtgacgatgtcgatgttgcggtggttggagctgttgtgcacctatg |
310 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16162 |
accagcggtgctaaaagtctggtgatggtgtcgatgttgcggtggttggagctgttgtgcacctatg |
16096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 245 - 310
Target Start/End: Original strand, 29885580 - 29885645
Alignment:
| Q |
245 |
ccagtggtgctaaaagtctggtgacgatgtcgatgttgcggtggttggagctgttgtgcacctatg |
310 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29885580 |
ccagtgctgctaaaagtctggtgtcagtgtcgatgttgcggtggttcgagctgttgtgcacctatg |
29885645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0237 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0237
Description:
Target: scaffold0237; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 247 - 310
Target Start/End: Original strand, 25133 - 25196
Alignment:
| Q |
247 |
agtggtgctaaaagtctggtgacgatgtcgatgttgcggtggttggagctgttgtgcacctatg |
310 |
Q |
| |
|
|||| |||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25133 |
agtgctgctaaaagtctggtgtcagtgtcgatgttgcggtggttcgagctgttgtgcacctatg |
25196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 247 - 297
Target Start/End: Complemental strand, 22291802 - 22291752
Alignment:
| Q |
247 |
agtggtgctaaaagtctggtgacgatgtcgatgttgcggtggttggagctg |
297 |
Q |
| |
|
||||||||||||||||||||| ||||| | ||||||||||||| |||||| |
|
|
| T |
22291802 |
agtggtgctaaaagtctggtgtcgatgccattgttgcggtggttcgagctg |
22291752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 246 - 310
Target Start/End: Original strand, 32277549 - 32277613
Alignment:
| Q |
246 |
cagtggtgctaaaagtctggtgacgatgtcgatgttgcggtggttggagctgttgtgcacctatg |
310 |
Q |
| |
|
|||||||||| |||||| |||| | ||| | ||||||||||||| |||||||||||||| |||| |
|
|
| T |
32277549 |
cagtggtgctgaaagtccggtgttggtgtggttgttgcggtggttcgagctgttgtgcacgtatg |
32277613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University