View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16378_low_65 (Length: 320)

Name: NF16378_low_65
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16378_low_65
NF16378_low_65
[»] scaffold0352 (2 HSPs)
scaffold0352 (1-178)||(16228-16403)
scaffold0352 (244-310)||(16096-16162)
[»] chr6 (1 HSPs)
chr6 (245-310)||(29885580-29885645)
[»] scaffold0237 (1 HSPs)
scaffold0237 (247-310)||(25133-25196)
[»] chr4 (1 HSPs)
chr4 (247-297)||(22291752-22291802)
[»] chr2 (1 HSPs)
chr2 (246-310)||(32277549-32277613)


Alignment Details
Target: scaffold0352 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: scaffold0352
Description:

Target: scaffold0352; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 16403 - 16228
Alignment:
1 agtcaattgacaccaggtttctttacagtctttgctcaccttttcagctttttcactctattatcacgccttcctaatatcaataattgatttacccnnn 100  Q
    |||||||||| | |||||| ||||| | | |||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||       
16403 agtcaattgaaaacaggttcctttaaattttttgctcaccctttcatctttttcactctattctcacgccttcctaatatcaataattgatttaccc--t 16306  T
101 nnnnnnnngaagaggcataatcgatttacccttattggtgatctattctcactgtagtcaattatttcgaagtttatg 178  Q
            ||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||    
16305 ttttttttgaagaggcataatcgatttacacttattggcgatctattctcaccgtagtcaattatttcgaagtttatg 16228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0352; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 244 - 310
Target Start/End: Complemental strand, 16162 - 16096
Alignment:
244 accagtggtgctaaaagtctggtgacgatgtcgatgttgcggtggttggagctgttgtgcacctatg 310  Q
    ||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||    
16162 accagcggtgctaaaagtctggtgatggtgtcgatgttgcggtggttggagctgttgtgcacctatg 16096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 245 - 310
Target Start/End: Original strand, 29885580 - 29885645
Alignment:
245 ccagtggtgctaaaagtctggtgacgatgtcgatgttgcggtggttggagctgttgtgcacctatg 310  Q
    |||||| |||||||||||||||| |  ||||||||||||||||||| |||||||||||||||||||    
29885580 ccagtgctgctaaaagtctggtgtcagtgtcgatgttgcggtggttcgagctgttgtgcacctatg 29885645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 247 - 310
Target Start/End: Original strand, 25133 - 25196
Alignment:
247 agtggtgctaaaagtctggtgacgatgtcgatgttgcggtggttggagctgttgtgcacctatg 310  Q
    |||| |||||||||||||||| |  ||||||||||||||||||| |||||||||||||||||||    
25133 agtgctgctaaaagtctggtgtcagtgtcgatgttgcggtggttcgagctgttgtgcacctatg 25196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 247 - 297
Target Start/End: Complemental strand, 22291802 - 22291752
Alignment:
247 agtggtgctaaaagtctggtgacgatgtcgatgttgcggtggttggagctg 297  Q
    ||||||||||||||||||||| ||||| |  ||||||||||||| ||||||    
22291802 agtggtgctaaaagtctggtgtcgatgccattgttgcggtggttcgagctg 22291752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 246 - 310
Target Start/End: Original strand, 32277549 - 32277613
Alignment:
246 cagtggtgctaaaagtctggtgacgatgtcgatgttgcggtggttggagctgttgtgcacctatg 310  Q
    |||||||||| |||||| ||||  | ||| | ||||||||||||| |||||||||||||| ||||    
32277549 cagtggtgctgaaagtccggtgttggtgtggttgttgcggtggttcgagctgttgtgcacgtatg 32277613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University