View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_low_85 (Length: 268)
Name: NF16378_low_85
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_low_85 |
 |  |
|
| [»] scaffold0902 (1 HSPs) |
 |  |  |
|
| [»] scaffold1118 (2 HSPs) |
 |  |  |
|
| [»] scaffold0571 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0902 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: scaffold0902
Description:
Target: scaffold0902; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 87 - 252
Target Start/End: Original strand, 1281 - 1446
Alignment:
| Q |
87 |
aatctgtctttatacaagtagaaggaacaaaactggcagatacggcaattttctcaatctaatttataaaagcttaattattcaagcttattttgtaatt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1281 |
aatctgtctttatacaagtagaaggaacaaaactggcagatacgacaattttctcaatctaatttataaaagcttaattattcaagcttattttgtaatt |
1380 |
T |
 |
| Q |
187 |
tatactcacgttcaatccgtttcatagagaatgattgtagaataatcaaagtgcaacatataagtg |
252 |
Q |
| |
|
||| | | ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1381 |
tattcccgcgttcaatccgcttcatagagaatgacattagaataatcaaagtgcaacatataagtg |
1446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1118 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: scaffold1118
Description:
Target: scaffold1118; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 160 - 252
Target Start/End: Original strand, 1613 - 1705
Alignment:
| Q |
160 |
ttaattattcaagcttattttgtaatttatactcacgttcaatccgtttcatagagaatgattgtagaataatcaaagtgcaacatataagtg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||| |||||||| |||||||||||||||||||| |
|
|
| T |
1613 |
ttaattattcaagcttattttgtaatttatactcacgttcaatccgcttcgtagataatgatattagaataaccaaagtgcaacatataagtg |
1705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1118; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 11 - 86
Target Start/End: Original strand, 1369 - 1444
Alignment:
| Q |
11 |
taacctgttcaactttctcttttgaagcacaaagcacaatggctcggggaggctttgaattcgaagcaagcgactc |
86 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| |||||| |||||||||| ||||||| |||||||||| |
|
|
| T |
1369 |
taacctgttcaacttttacttctgaagcacaaagcacaacggctcgaggaggctttgtattcgaaccaagcgactc |
1444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0571 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: scaffold0571
Description:
Target: scaffold0571; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 145 - 252
Target Start/End: Original strand, 6776 - 6883
Alignment:
| Q |
145 |
ctaatttataaaagcttaattattcaagcttattttgtaatttatactcacgttcaatccgtttcatagagaatgattgtagaataatcaaagtgcaaca |
244 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||| | | ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6776 |
ctaattcataaaagcttaattattgaagcttattttgtaatttattcccgcgttcaatccgcttcatagagaatgacattagaataatcaaagtgcaaca |
6875 |
T |
 |
| Q |
245 |
tataagtg |
252 |
Q |
| |
|
| |||||| |
|
|
| T |
6876 |
tctaagtg |
6883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0571; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 86
Target Start/End: Original strand, 6529 - 6602
Alignment:
| Q |
13 |
acctgttcaactttctcttttgaagcacaaagcacaatggctcggggaggctttgaattcgaagcaagcgactc |
86 |
Q |
| |
|
|||||||||||| |||| | | |||||||||| |||| |||||| ||| |||||||||||||| ||||| |||| |
|
|
| T |
6529 |
acctgttcaactctctcctctaaagcacaaagaacaacggctcgaggatgctttgaattcgaaccaagcaactc |
6602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 86
Target Start/End: Original strand, 14389951 - 14390024
Alignment:
| Q |
13 |
acctgttcaactttctcttttgaagcacaaagcacaatggctcggggaggctttgaattcgaagcaagcgactc |
86 |
Q |
| |
|
||||||||||||||||| | |||||||||||| |||| |||||| ||| ||||||||| ||| ||||| |||| |
|
|
| T |
14389951 |
acctgttcaactttctcctctgaagcacaaagaacaacggctcgaggatactttgaattagaaccaagcaactc |
14390024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University