View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_low_87 (Length: 265)
Name: NF16378_low_87
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_low_87 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 16 - 260
Target Start/End: Original strand, 35173672 - 35173916
Alignment:
| Q |
16 |
ttaacttaggcaagtttggtgaaatgatggttgaaatgttaccacaagatcttgctttcacagtttttgttccttctgaagaagcttttaaacgtgatct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35173672 |
ttaacttaggcaagtttggtgaaatgatggttgaaatgttaccacaagatcttgctttcacagtttttgttccttctgaagaagcttttaaacgtgatct |
35173771 |
T |
|
| Q |
116 |
acgtttgagtgtgaatgatagtttgaaacaagacaagtttaatgatacatatgcaattgtgagtcgtgtgttgggtttttctgttgtacctcgtacacta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35173772 |
acgtttgagtgtgaatgatagtttgaaacaagacaagtttaatgatacatatgcaattgtgagtcgtgtgttgggtttttctgttgtacctcgtacacta |
35173871 |
T |
|
| Q |
216 |
tgttctgttgatttaaggtttggtgaggttgtgtcctatgcttct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
35173872 |
tgttctgttgatttaaggtttggtgaggttgtgtcttatgattct |
35173916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University