View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_low_99 (Length: 244)
Name: NF16378_low_99
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_low_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 73 - 225
Target Start/End: Original strand, 41236481 - 41236632
Alignment:
| Q |
73 |
tcttctgtgattttactcgagttcactgcgattaaactcgacttcatggaattgaaattgatactcagactcaaagtttagttcactgcgtgtttaccaa |
172 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
41236481 |
tcttctgtgactttactcgagttcactgcgattaaactcgacttcatggaattgaaattgatacttagactcaaagtttagttcactgcatgtttaccaa |
41236580 |
T |
 |
| Q |
173 |
agtttactaaaatttgagtttacagttagatcaacttgaaatagatcattaga |
225 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41236581 |
agtttactaaaatttgag-ttacagttagatcaacttgaaatagatcattaga |
41236632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University