View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16379_high_20 (Length: 266)
Name: NF16379_high_20
Description: NF16379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16379_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 15 - 255
Target Start/End: Original strand, 37554123 - 37554363
Alignment:
| Q |
15 |
gatcggacctcccggtacggggaaaatgatgtctgcaaaggcagtttgcaaacgaagatgggacaagcttcatcaatgtatcttcgtccatcattagtgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37554123 |
gatcggacctcccggtacggggaaaatgatgtctgcaaaggcagtttgcaaacgaagatgggacaagcttcatcaatgtatcttcgtccatcattagtgg |
37554222 |
T |
 |
| Q |
115 |
aatgttgttcggacaaagtgaaaagaacgttcgagctctatttttattagcgacaaagttggccccaacaattatttttattgttgaagttgataaataa |
214 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37554223 |
aatgttgttcgaacaaagtgaaaagaacgttcgagctctgtttttattagcgacaaagttggccccaacaattatttttattgttgaagttgataaataa |
37554322 |
T |
 |
| Q |
215 |
tatgggaacaccacacagaggaggattaaatttgaattcat |
255 |
Q |
| |
|
||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37554323 |
tatacgaacaccacacagaggaggattaaattttaattcat |
37554363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University