View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16379_high_4 (Length: 565)
Name: NF16379_high_4
Description: NF16379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16379_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 8e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 452 - 549
Target Start/End: Original strand, 1253574 - 1253671
Alignment:
| Q |
452 |
aacataatgagaatttagcaggatgttacactctatccccctaaagaaaatttcgtcctcgaaatttagaaattcacctaaggatagaaacatataat |
549 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1253574 |
aacataatgagaatttagcgggatgttacactctatcccactaaagaaaatttcgttctcgaaatttagaaattcacctaaggatagaaacatataat |
1253671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 472 - 526
Target Start/End: Complemental strand, 2441 - 2387
Alignment:
| Q |
472 |
ggatgttacactctatccccctaaagaaaatttcgtcctcgaaatttagaaattc |
526 |
Q |
| |
|
|||| |||||||||| |||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
2441 |
ggatattacactctaccccccttaaagaaatttcgtcctcgaaatttagagattc |
2387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University