View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16379_low_17 (Length: 304)
Name: NF16379_low_17
Description: NF16379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16379_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 294
Target Start/End: Complemental strand, 37673098 - 37672822
Alignment:
| Q |
19 |
aataattcattaacaaattcaaaaccaaagaagggcagcttgcaatgagtaatagaaaaatcagaatgcaccatgttttcattaagtcaattttcattaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37673098 |
aataattcattaacaaattcaaaaccaaagaagggcagcttgcaatgagtaatagaaaaatcagaatgcaccatgttttcattaagtcaattttcattaa |
37672999 |
T |
|
| Q |
119 |
tagaaacacatactttaaagatattattaaactgtaaaacacaaaatgaaactagaaatctactactattatacatctttttgaacaggtaaacccaaaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37672998 |
tagaaacacatactttaaagatattattaaactgtaaaacacaaaatgaaactagaaatgtactactattatacat-tttttgaacaggtaaacccaaaa |
37672900 |
T |
|
| Q |
219 |
attaattttagtacatagtattttgtcactt--tgtctttattacccaattgtctttcactttcttcaatcacctttg |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37672899 |
attaattttagtacatagtattttgtcactttgtgtttttattacccaattgtctttcactttcttcaatcacctttg |
37672822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University