View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16379_low_23 (Length: 256)
Name: NF16379_low_23
Description: NF16379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16379_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 37007234 - 37007474
Alignment:
| Q |
1 |
aagagcataacatatttcagggatagatcttaatgcccaattagtgatccaaatatatgacaagcactctctaaattgtagcttaccaaatagggtacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37007234 |
aagagcataacatatttcagggatagatcttaatgcccaattagtgatccaaatatatgacaagcactctctaaattgtagcttaccaaatagggtacca |
37007333 |
T |
 |
| Q |
101 |
aaaattggacaatgcttgctaaggaagatatcaagcaaccctgaagaccatcttttatgttgggccatttggcccaagttatcttgtggtgaacagccca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37007334 |
aaaattggacaatgcttgctaaggaagatatcaagcaaccctgtagaccatcttttatgttgggccatttggcccaagttatcttgtggtgaacagccca |
37007433 |
T |
 |
| Q |
201 |
taaaagctattgggtctggtgaacaaagctcagatctccat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37007434 |
taaaagctattgggtctggtgaacaaagctcagatctccat |
37007474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University