View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1637_low_19 (Length: 244)
Name: NF1637_low_19
Description: NF1637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1637_low_19 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 40514437 - 40514235
Alignment:
Q |
19 |
agtatgacataacatttataagaaaatgaatcaatgaatgaatatacttctgcattacctatcttttgcttttcaatagcctccataggtgtggaggata |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40514437 |
agtatgacataacatttataagaaaatgaatcaatgaatgaatatacttctgcattacctatcttttgcttttcaatagcctccataggtgtggaggata |
40514338 |
T |
|
Q |
119 |
agttgcttgcagcagagggaaatgctttggaatatttctcactttaattggtgctccttccattttttgttggtgtatatatgtaagaaacttattttgt |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40514337 |
agttgcttgcagcagagggaaatgctttggaatatttctcactttaattggtgctccttccattttttgttggtgtatatatgtaagaaacttattttgt |
40514238 |
T |
|
Q |
219 |
tgt |
221 |
Q |
|
|
||| |
|
|
T |
40514237 |
tgt |
40514235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4391 times since January 2019
Visitors: 5882