View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1638-INSERTION-10 (Length: 161)
Name: NF1638-INSERTION-10
Description: NF1638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1638-INSERTION-10 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 8e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 8e-75
Query Start/End: Original strand, 8 - 161
Target Start/End: Complemental strand, 27973242 - 27973089
Alignment:
| Q |
8 |
gaaactaattttcttttttattgaaaaattactagtctactttttgaacattcctcattttgttaaccattaaaatgtgtaatgtaggacttgatggggt |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27973242 |
gaaactgattttcttttttattgaaaaattactagtctactttttgaacattcctcattttgttaaccattaaaatgtgtaatgtaggacttgatggggt |
27973143 |
T |
 |
| Q |
108 |
tgtgtctgttttctcgaataaaaagcgaaaactccttacaaccaaatcatggga |
161 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27973142 |
ggtgtctgttttcccgaataaaaagcgaaaactccttacaaccaaatcatggga |
27973089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University