View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1638-INSERTION-11 (Length: 196)
Name: NF1638-INSERTION-11
Description: NF1638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1638-INSERTION-11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 196
Target Start/End: Complemental strand, 12219067 - 12218878
Alignment:
| Q |
7 |
acaaactaaagggaaaggacgatgctattgagttgtctcattttcaccattagtagcatgaatgaatctcatctattctcattcattttgtaaagtcaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12219067 |
acaaactaaagggaaaggacgatgctattgagttgtctcattttcaccattagtagcatgaatgaatctcatctattctcattcattttgtaaagtcaat |
12218968 |
T |
|
| Q |
107 |
tctcagatgatatatattacaccaacatttctatgcaataagcaaagaaggttggttatcttgctaaaaattcatttcatattttacaag |
196 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12218967 |
tctcagatgatatatactacaccaacatttctatgcaataagcaaagaaggttggttatcttgctaaaaattcatttcatattttacaag |
12218878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University