View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1638-INSERTION-12 (Length: 229)
Name: NF1638-INSERTION-12
Description: NF1638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1638-INSERTION-12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 10565652 - 10565875
Alignment:
| Q |
7 |
actattattcatagaagggttttgtgcccttatgggtagatattgtacaaacttaactctcccttttttgtctttcgatcaacatcaatggctacatata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10565652 |
actattattcatagaagggttttgtgcccttatgggtagatattgtacaaacttaactctcccttttttgtctttcgatcaacatcaatggctacatata |
10565751 |
T |
|
| Q |
107 |
tgacaatgaaagaagattaattaga-aataaaattgccaccaaaccaacagtttgcccaatagggaaagtgtaacaagagtgagaggaccacaattatcc |
205 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10565752 |
tgacaatgaaagaagattaattagacaataaaattgccaccaaaccaacagtttgcccaatagggaaagtgtaacaagagtgagaggaccacaattatcc |
10565851 |
T |
|
| Q |
206 |
ttattggaccacttcttttagtag |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10565852 |
ttattggaccacttcttttagtag |
10565875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University