View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1638-INSERTION-2 (Length: 122)

Name: NF1638-INSERTION-2
Description: NF1638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1638-INSERTION-2
NF1638-INSERTION-2
[»] chr2 (1 HSPs)
chr2 (7-122)||(12691626-12691741)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 7 - 122
Target Start/End: Complemental strand, 12691741 - 12691626
Alignment:
7 agggttaccaagtgtaggtagcattacaaaaataaatatgagtttagaaattattaccacatagaagatgaacatttgctgttagtgttcttgctgaaat 106  Q
    ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12691741 agggttaccaaatgtaggtagcatgacaaaaataaatatgagtttagaaattattaccacatagaagatgaacatttgctgttagtgttcttgctgaaat 12691642  T
107 agtattccctttaccc 122  Q
    ||||||||||||||||    
12691641 agtattccctttaccc 12691626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University