View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1638-INSERTION-5 (Length: 88)
Name: NF1638-INSERTION-5
Description: NF1638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1638-INSERTION-5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 8e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 8e-30
Query Start/End: Original strand, 11 - 88
Target Start/End: Original strand, 38030440 - 38030517
Alignment:
| Q |
11 |
actattatcgacaagacgacaaccaattgatggataaaggtacgtactagttttgatgagaacgactttagtaagacg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
38030440 |
actattatcgacaagacgacaaccaattaatggataaaggtacgtactagttttgatgataacgactttagcaagacg |
38030517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University