View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1638-INSERTION-6 (Length: 334)
Name: NF1638-INSERTION-6
Description: NF1638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1638-INSERTION-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 7e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 147 - 237
Target Start/End: Original strand, 8264191 - 8264281
Alignment:
| Q |
147 |
ctataagtattacattatataagataagattgtggctaatattagttatcaacattaatgttgtgatgcacaatgttctttttttcctttg |
237 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
8264191 |
ctataagtattacattacataagataagattgtggctaatattagttatcaacattaatgttgtgaggcacagtgttctttttttcctttg |
8264281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 5 - 130
Target Start/End: Original strand, 8263997 - 8264121
Alignment:
| Q |
5 |
acaaaaagcatataggattagaaggatgagctactatctatgcctgcatgnnnnnnnnnnnnnnnncgataaagatatgtaaatatttgtttgtttggtt |
104 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8263997 |
acaaaaagcatataggatt-gagggatgagctactatctatgcctgcatgaaaaataaaagaaaaacgataaagatatgtaaatatttgtttgtttggtt |
8264095 |
T |
|
| Q |
105 |
gtgtgtataaaataatctttataatt |
130 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
8264096 |
gtgtttataaaataatctttataatt |
8264121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University