View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16380_high_32 (Length: 248)
Name: NF16380_high_32
Description: NF16380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16380_high_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 38054821 - 38054604
Alignment:
| Q |
16 |
catcaaacgagcttttgtttcgtatgtagtcacttggcttctggtgagaaagaaggcgatgaggtgaggaggaattctgatgtagctgagattcttaaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38054821 |
catcaaacgagcttttgtttcgtatgtagtcacttggcttctggtgagaaagaaggcgatgaggtgaggaggaattctgatgtagctgagattcttaaag |
38054722 |
T |
|
| Q |
116 |
gcatacaattccctaggatttgtaagaatccataccgtcgagcaccagaaaagatagtggatcatgagtaagttatcacacacatatgtatctttgactg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38054721 |
gcatacaattccctaggatttgtaagaatccataccgtcgagcaccagaaaagatagtggatcatgagtaagttatcacacacatatgtatctttgactg |
38054622 |
T |
|
| Q |
216 |
acttatcaaaatacatgt |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
38054621 |
acttatcaaaatacatgt |
38054604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University