View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16380_low_24 (Length: 291)
Name: NF16380_low_24
Description: NF16380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16380_low_24 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 77 - 291
Target Start/End: Original strand, 5294063 - 5294277
Alignment:
| Q |
77 |
aagttgaaacatatgagaatcaattcagattcaaatcatgcaaaaattatgcagaaagaaaagaagatttctcaaccttcatgttttgatattggtggaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5294063 |
aagttgaaacatatgagaatcaattcagattcaaatcatgcaaaaattaagcagaaagaaaagaagatttctcaaccttcatgttttgatattggtggaa |
5294162 |
T |
|
| Q |
177 |
aatatggtaacaaaagtggaagaaaacaaggtatagtcaagttaaaagaggaggatattattggtttagaagatcaaagaaaaatggtgaatgataagaa |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5294163 |
aatatggtaacaaaagtggaagaaaacaaggtatagtcaagttaaaggaggaggatattattggtttagaagatcaaagaaaaatggtgaatgataagaa |
5294262 |
T |
|
| Q |
277 |
gggtttgatgaagat |
291 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5294263 |
gggtttgatgaagat |
5294277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University