View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16380_low_39 (Length: 236)
Name: NF16380_low_39
Description: NF16380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16380_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 217
Target Start/End: Complemental strand, 43452569 - 43452364
Alignment:
| Q |
12 |
aagaaaatatgaaagaatattgtccgatgatgatgtgaaaatggttgttgaagacaatagagaggaatccctgtggggaatccgttaaggttgcagaatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452569 |
aagaaaatatgaaagaatattgtccgatgatgatgtgaaaatggttgttgaagacaatagagaggaatccctgtggggaatccgttaaggttgcagaatc |
43452470 |
T |
|
| Q |
112 |
agattatcaccaatgaaaagcctattatatgtttcctgagcttatctatgtcggtaacattactgatgcttgatggctcctggtttaaagataattccca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452469 |
agattatcaccaatgaaaagcctattatatgtttcctgggcttatctatgtcggtaacattactgatgcttgatggctcctggtttaaagataattccca |
43452370 |
T |
|
| Q |
212 |
gtttgc |
217 |
Q |
| |
|
|||||| |
|
|
| T |
43452369 |
gtttgc |
43452364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University