View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16380_low_41 (Length: 212)

Name: NF16380_low_41
Description: NF16380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16380_low_41
NF16380_low_41
[»] chr8 (2 HSPs)
chr8 (1-92)||(42396082-42396169)
chr8 (148-190)||(42396011-42396053)


Alignment Details
Target: chr8 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 42396169 - 42396082
Alignment:
1 accctaattaaatttgtccttttatggagggaagattcttacaagttacnnnnnnnngcgcgtggaatgaatgaattatatttggaaaaacc 92  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||        |||||||    ||||||||||||||||||||||||    
42396169 accctaattaaatttgtctttttatggagggaagattcttacaagttacaaaaaaaagcgcgtg----gaatgaattatatttggaaaaacc 42396082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 148 - 190
Target Start/End: Complemental strand, 42396053 - 42396011
Alignment:
148 tttcatttcattggacggacagctagctgtttgcaagaatata 190  Q
    |||||||||||||||||||||||||||||||||||||||||||    
42396053 tttcatttcattggacggacagctagctgtttgcaagaatata 42396011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University