View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16381_high_14 (Length: 326)
Name: NF16381_high_14
Description: NF16381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16381_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 20 - 316
Target Start/End: Complemental strand, 28362783 - 28362487
Alignment:
| Q |
20 |
gagaattcgtcgaggaagatgaggagttggagtttgagttgaagaggggaatctttgcggaggagtgaggataagagatgatcggagagaggtggatcga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28362783 |
gagaattcgtcgaggaagatgaggagttggagtttgagttgaagaggggaatctttgcggaggagtgaggataagagatgatcggagagaggtggatcga |
28362684 |
T |
|
| Q |
120 |
gagagttccatttttcggtggcggtgttggattggaaattttcgattaaggtttcccattcgtggtgggttagtggctttgacggtggtggcgccgtcat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28362683 |
gagagttccatttttcggtggcggtgttggattggaaattttcgattaaggtttcccattcgtggtgggttagtgactttgacggtggtggcgccgtcat |
28362584 |
T |
|
| Q |
220 |
ggcgaaccggaggtgcgatgcggttcgttaagtttgtttactttacactcagatgaacaaagcgttaacgaccgcaatacacgtgtagtttctgatg |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
28362583 |
ggcgaaccggaggtgcgatgcggttcgttaagtttgtttactttacacttagatgaacaaagcgttaacgacggcaatacacgtgtagtttcggatg |
28362487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University