View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16381_low_3 (Length: 589)
Name: NF16381_low_3
Description: NF16381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16381_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 18 - 302
Target Start/End: Complemental strand, 29586218 - 29585934
Alignment:
| Q |
18 |
ttttgtattcaaggtcattttctgaggatggcctgcattagattggcaagccgtgctaatctcacattattgtatcttgtattgtccataaatgtcgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29586218 |
ttttgtattcaaggtcattttctgaggatggcctgcattagattggcaagccgtgctaatctcacattattgtatcttgtattgtccataaatgtcaaaa |
29586119 |
T |
 |
| Q |
118 |
ttattgaccttgttggctgtgaacttgtttattccaaagaattggtttcaatcaaactgcaattcaattgtgtcatccaatgggatatgatgcacccact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29586118 |
ttattgaccttgttggctgtgaacttgtttattccaaattattggtttcaatcaaactgcaattcaattgtgtcatccaatgggatatgatgcacccact |
29586019 |
T |
 |
| Q |
218 |
ttctgtcattcttgcttctatctttaacaagctttattttttcattcatgctgtacatgaagatatgcagatttagttcaaagat |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29586018 |
ttctgtcattcttgcttctatctttaacaagctttattttttcattcatgctgtacatgaagatatgcagatttagttcaaagat |
29585934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University