View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16381_low_7 (Length: 449)
Name: NF16381_low_7
Description: NF16381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16381_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 111 - 202
Target Start/End: Original strand, 50362544 - 50362635
Alignment:
| Q |
111 |
atattgcgagagaaagatatgttaatttttggagtttcaggactgttttcgcaaggcatttggcaaacatgtatggagattttgggttcttt |
202 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
50362544 |
atattgcgagagaaagatatgtcaattattggagtttcaggactgttgttgcaaggcatttggcaaacatgtatggagatttttgcttcttt |
50362635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 433
Target Start/End: Complemental strand, 8772622 - 8772566
Alignment:
| Q |
377 |
tgagttttgtgtttgttacaagtgtaatagccctttgtggagttggttaatcaaata |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
8772622 |
tgagttttgtgtttgttacaagtataatacccctttgtggagttggctaatcaaata |
8772566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University