View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16382_low_12 (Length: 288)
Name: NF16382_low_12
Description: NF16382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16382_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 30 - 208
Target Start/End: Original strand, 14248765 - 14248943
Alignment:
| Q |
30 |
attaccgttttctagttcaaagattgatgaaatgaaatggttattcatggttttggattatggtccaatggagaaaatgatgagaggttcactaggagag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14248765 |
attaccgttttctagttcaaagattgatgaaatgaaatggttattcatggttttggattatggtccaatggagaaaatgatgagaggttcactaggagag |
14248864 |
T |
|
| Q |
130 |
tgtgagagctcctagcagaggttcgctggggttcattgagaacatgatcgactttcaattagggttcattgtgggattc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14248865 |
tgtgagagctcctagcagaggttcgctggggttcattgagaacatgatcgactttcaattagggttcattgtgggattc |
14248943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 113
Target Start/End: Original strand, 14866162 - 14866262
Alignment:
| Q |
13 |
cggagtataattgccaaattaccgttttctagttcaaagattgatgaaatgaaatggttattcatggttttggattatggtccaatggagaaaatgatga |
112 |
Q |
| |
|
|||||||| |||| |||||||||||||||| || ||||||||||| ||||| || |||||| || || |||| ||||| ||||||| || ||||||| |
|
|
| T |
14866162 |
cggagtattcttgcgaaattaccgttttctacatccaagattgatgagatgaaggggctattcaaggcttcggataatggttcaatggaaaagatgatga |
14866261 |
T |
|
| Q |
113 |
g |
113 |
Q |
| |
|
| |
|
|
| T |
14866262 |
g |
14866262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 14248445 - 14248479
Alignment:
| Q |
1 |
tccttttgatcacggagtataattgccaaattacc |
35 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14248445 |
tccttttgatctcggagtataattgccaaattacc |
14248479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 113
Target Start/End: Complemental strand, 14234922 - 14234845
Alignment:
| Q |
36 |
gttttctagttcaaagattgatgaaatgaaatggttattcatggttttggattatggtccaatggagaaaatgatgag |
113 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| |||| || || || |||| ||||| |||| |||||||||||||| |
|
|
| T |
14234922 |
gttttctacttcaaagatcgatgaaatgaaaccattatgcaaggcttcggataatggttcaatagagaaaatgatgag |
14234845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University