View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16385_high_3 (Length: 310)
Name: NF16385_high_3
Description: NF16385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16385_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 299
Target Start/End: Complemental strand, 42059583 - 42059306
Alignment:
| Q |
18 |
aattgaaaatcaagtgtgagtgattatatctcaatataaataatacttaaggtttttggtggaaattcgtgtctttgatgtaatgtatttgttcactttt |
117 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42059583 |
aattgaaaatcaagtgcgagtgattatgtctcaatataaataatacttaagatttttggtggaaattcgtgtctttgatgtaatgtatttattcactttt |
42059484 |
T |
 |
| Q |
118 |
ttcgatgtcaaatttttcaatgttctcgtccataaagttcaaacacaaaaccttaagaaatctcaatctagttatagttataaataatcagatcaatgtc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42059483 |
ttcgatgtcaaatttttcaatgttctcgtccataaagttcaaacacaaaaccttaagaaatctcaatctagttatagtt----ataatcagatcaatgta |
42059388 |
T |
 |
| Q |
218 |
atgtttaaaatgttatcatccatcatgatggtgtggttgttgttaataaagaaataaatcatcgggttatccctaaagaatt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42059387 |
atgtttaaaatgttatcatccatcatgatggtgtggttgttgttaataaagaaataaatcatcgggttatccctaaagaatt |
42059306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University