View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16385_low_2 (Length: 406)
Name: NF16385_low_2
Description: NF16385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16385_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 43529270 - 43529013
Alignment:
| Q |
1 |
agtggagtagcataggacgaaagcgagaccgaagccagggctggtggggttgtctggtaagatggagaagatgaaggaagtggagaaggaagtgatgttt |
100 |
Q |
| |
|
||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43529270 |
agtggtgttgcagaggacgaaagcgagaccgaagccagggctggtggggttgtctggtaagatggagaagatgaaggaagtggagaaggaagtgatgttt |
43529171 |
T |
|
| Q |
101 |
gttgaggaaggtgaaggtttgagcatggggagtttagtggggtggaaggcacggccgtaagagtattggttggagtcgttggtcatgcggatgacaggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43529170 |
gttgaggaaggtgaaggtttgagcatggggagtttagtggggtggaaggcacggccgtaagagtattggttggagtcgttggtcatgcggatgacaggtg |
43529071 |
T |
|
| Q |
201 |
gttggatgtgggcgtcggggatgagagtgaggttggtggtggtggtgaaggagttgta |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43529070 |
gttggatgtgggcgtcggggatgagagtgaggttggtggtggtggtgaaggagttgta |
43529013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 337 - 391
Target Start/End: Complemental strand, 43528922 - 43528868
Alignment:
| Q |
337 |
attcatgccggagatttgttcgccggcgagtgtaggagacagaatgagttgagtt |
391 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
43528922 |
attcatgccggagatttgttcgccggtgagtgtagataacagaatgagttgagtt |
43528868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University