View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16387_high_7 (Length: 266)
Name: NF16387_high_7
Description: NF16387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16387_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 254
Target Start/End: Complemental strand, 50567001 - 50566766
Alignment:
| Q |
19 |
cttcccagaagaatagacaagtgcagttgcttttggttttctgatcttcataatgagaaaagggaaatgctacaaagaattttgcatcacaaacatcgat |
118 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50567001 |
cttcccagaagaatagataagtgcagttgcttttggttttctgatcttcataatgagaaaagggaaatgctgcaaagaattttgcatcacaaacatcgat |
50566902 |
T |
|
| Q |
119 |
cagtgccactaaagcaagcatatttatcaatgcaaaggaaaaagtaagcacgcgcatgcaacacaaagacttgcatacataacacagatggtatttgaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50566901 |
cagtgccactaaagcaagcatatttatcaatgcaaaggaaaaagtaagcacgcgcatgcaacacacagacttgcatacataacacagatggtatttgaat |
50566802 |
T |
|
| Q |
219 |
gagattcacaatgaatgagcagatgaaacttgcctt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50566801 |
gagattcacaatgaatgagcagatgaaacttgcctt |
50566766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 23 - 254
Target Start/End: Complemental strand, 50572837 - 50572611
Alignment:
| Q |
23 |
ccagaagaatagacaagtgcagttgcttttggttttctgatcttcataatgagaaaagggaaatgctacaaagaattttgcatcacaaacatcgatcagt |
122 |
Q |
| |
|
||||||| | ||| ||||||||||| |||||||| |||||||||||||| ||||||||| | | ||||||||||||||||||| || | | |||||| |
|
|
| T |
50572837 |
ccagaagcagagataagtgcagttgtttttggttctctgatcttcataacgagaaaaggtatacgctacaaagaattttgcattacgatc----atcagt |
50572742 |
T |
|
| Q |
123 |
gccactaaagcaagcatatttatcaatgcaaaggaaaaagtaagcacgcgcatgcaacacaaagacttgcatacataacacagatggtatttgaatgaga |
222 |
Q |
| |
|
||| ||||| ||| |||||||| |||| ||||| ||||| |||||| || |||| || | |||||||||||||||||| || ||||||| |||| | |
|
|
| T |
50572741 |
gcctctaaaacaatcatatttaccaattgaaagg-aaaagcaagcacaagcgcacaacgcacacacttgcatacataacacatatagtatttggatgaca |
50572643 |
T |
|
| Q |
223 |
ttcacaatgaatgagcagatgaaacttgcctt |
254 |
Q |
| |
|
||||||| || ||||||||||||||||||||| |
|
|
| T |
50572642 |
ttcacaacgattgagcagatgaaacttgcctt |
50572611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University