View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16387_low_10 (Length: 247)
Name: NF16387_low_10
Description: NF16387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16387_low_10 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 34028029 - 34027790
Alignment:
| Q |
8 |
ataatactcctttgactcgtcccgttgttccggatgagaagaggattgctgctgtatctgattgacttgttataaccgggcgaagttcagtatgagtatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34028029 |
ataatactcctttgactcgtcccgttgttccggatgagaagaggattgctgctgtatctgattgacttgttacaaccgggcgaagttcagtatgagtatc |
34027930 |
T |
 |
| Q |
108 |
agtggtggaattgatcacggaaagaaaagaaggagaatcagttatgacagtgcctaggggtagtttagggattttggttgcggttgaggaagtggagaat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34027929 |
agtggtggaattgatcacggaaagaaaagaaggagaatcagttatgacagtgcctaggggtagtttagggatttttgttgcggttgaggaagtggagaat |
34027830 |
T |
 |
| Q |
208 |
gcgatgacgggattgatgagatgaacgagatgagataact |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34027829 |
gcgatgacgggattgatgagatgaacgagatgagataact |
34027790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 34018229 - 34017990
Alignment:
| Q |
8 |
ataatactcctttgactcgtcccgttgttccggatgagaagaggattgctgctgtatctgattgacttgttataaccgggcgaagttcagtatgagtatc |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| ||| ||||||||||| |||| |||||| |
|
|
| T |
34018229 |
ataatactcctttgactcgtccggttgttccggatgagaagaggatagctgctgtgtctgattgacttgtttcaacagggcgaagttcggtatcagtatc |
34018130 |
T |
 |
| Q |
108 |
agtggtggaattgatcacggaaagaaaagaaggagaatcagttatgacagtgcctaggggtagtttagggattttggttgcggttgaggaagtggagaat |
207 |
Q |
| |
|
| |||||||||||| ||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
34018129 |
aatggtggaattgagcacggaaagaaaagaaggagaatcaaagatgactgtgccgaggggtagtttagggatttttgttgcagttgaggaggtggagaat |
34018030 |
T |
 |
| Q |
208 |
gcgatgacgggattgatgagatgaacgagatgagataact |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34018029 |
gcgatgacgggattgatgagatgaacgagatgagataact |
34017990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University