View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16387_low_11 (Length: 240)
Name: NF16387_low_11
Description: NF16387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16387_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 42003439 - 42003219
Alignment:
| Q |
1 |
aacatttgacttctccgacacaccagctgaaacacttggtgaaacaaccatgtttggttttgtttcttcatgggataaaatcgaagatgacgaggagacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42003439 |
aacatttgacttctccgacacaccagctgaaacacttggtgaaacaaccatgtttggttttgtttcttcatgggataaaatcgaagatgacgaggacacg |
42003340 |
T |
|
| Q |
101 |
tgagcatgagggacactaacgttgtcggaagctttgtagccactaaaggctattagagaagcaagtaaaaacaatccacaaaaaatgagaagaagctcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003339 |
tgagcatgagggacactaacgttgtcggaagctttgtagccactgaaggctattagagaagcaagtaaaaacaatccacaaaaaatgagaagaagctcct |
42003240 |
T |
|
| Q |
201 |
tacgattgttattgtggggcc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42003239 |
tacgattgttattgtggggcc |
42003219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University