View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16388_high_2 (Length: 339)
Name: NF16388_high_2
Description: NF16388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16388_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 11 - 324
Target Start/End: Original strand, 32173403 - 32173715
Alignment:
| Q |
11 |
cacagaattcagcattcatgaacatcactgaaaacaaaaacataaaccagatctacaagctaacnnnnnnnatcacaaattgttatgcaagtacaataaa |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32173403 |
cacagaattcagcattcatgaatatcactgaaaacaaaaacataaaccagatctacaagctaactttttt-atcacaaattgttatgcaagtacaataaa |
32173501 |
T |
 |
| Q |
111 |
agacaagatttttaagcaagtaatcaccttaaagacagcaaaaaggaagaccaaagattcatcacagaagctatatccaaaaacagcatatccaaagtgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32173502 |
agacaagatttttaagcaagtaatcaccttaaaggcagcataaaggaagaccaaaaattcatcacagaagctatatccaaaaacagcatatccaaagtgc |
32173601 |
T |
 |
| Q |
211 |
ttattcactgaagaaactatgaaagttgctttcctgcttaagcgcttaatatatcaagcaaaagtgcttattcagtgaagaaactatgcagagaattttg |
310 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32173602 |
ttattcactgaagaagctatgaaagttgctttcctgcttaagcgcttaatatatcaagcaaaagtgcttattcagtgaagaaactatgcagagaattttg |
32173701 |
T |
 |
| Q |
311 |
catgtgaagtttga |
324 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32173702 |
catgtgaagtttga |
32173715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University