View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16388_high_3 (Length: 221)
Name: NF16388_high_3
Description: NF16388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16388_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 6316544 - 6316351
Alignment:
| Q |
13 |
agcagagatctgaatgtagataactaataaaaccatcggtaataaacaaccttatgttgcaagatatgtacaaaacggtggctcattttttaactaatat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316544 |
agcagagatctgaatgtagataactaataaaaccatcggtaataaacaaccttatgttgcaagatatgtacaaaacggtggctcattttttaactaatat |
6316445 |
T |
|
| Q |
113 |
ggttggataaatcattttaattgtgatttatgtgttgatttcatgcctctgccttgagtgtaatgtccattttgtgtatttagtatgatggagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316444 |
ggttggataaatcattttaattgtgatttatgtgttgatttcatgcctctgccttgagtgtaatgtccattttgtgtatttagtatgatggagg |
6316351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University