View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16389_high_9 (Length: 352)
Name: NF16389_high_9
Description: NF16389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16389_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 8 - 334
Target Start/End: Original strand, 34482650 - 34482972
Alignment:
| Q |
8 |
agataatactgagttgggaacgtagaagatatttatggctgacttaagagacaacaatccatatttttggcaagccctatataccgtaagaggactcaag |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
34482650 |
agataattctgagttgggaacgtagaagatatttatggctgacttaagagacaacaatccatatttttggcaatccctatataccgtaagaggactcgag |
34482749 |
T |
 |
| Q |
108 |
gatgagagaagttgaatttaggggtttagagacttacttacaacgaggactcgaggatgtatcagaaatgtgaaagaagaacgagttcggagacagaatt |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
34482750 |
gatgagagaagttgaatttagggttttagagacttacttacaacgaggactcgaggatgtatcataaatgtgaaagaagaacgagttcggagacataatt |
34482849 |
T |
 |
| Q |
208 |
gaaggactcagatcaatatgattatatccaaaaataatttgaagaaactcatactaatattccgatcccctccctggttcggggagaatcacagcgctaa |
307 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34482850 |
gaaggactcag----atatgattatatccaaaaataatttgaagaaactcatactaatattccgatcccctccctggttcggggagaatcacagcgctaa |
34482945 |
T |
 |
| Q |
308 |
taagcttgccaatgtaggtttatcctt |
334 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34482946 |
taagcttgccaatgtaggtttatcctt |
34482972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University