View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16389_low_13 (Length: 332)
Name: NF16389_low_13
Description: NF16389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16389_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 45 - 288
Target Start/End: Complemental strand, 44934888 - 44934645
Alignment:
| Q |
45 |
ctctcctctccactgattcagtttatatgccaccatttcattgtttttgcgccaccatgtgtcgtggcaaaagctttttaagtttaacgttgatgtaatt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44934888 |
ctctcctctccactgattcagtttatatgccaccatttcattgtttttgcgccaccatgtgtcgtggcaaaagctttttaagtttaacgttgatgtaatt |
44934789 |
T |
 |
| Q |
145 |
atttgtgctccacttctgctttttcttttacgttgttatggttcttgcatgcattatttatcatactgaagaaggttgcagggagtagtaacaacgtgcc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44934788 |
atttgtgctccacttctgctttttcttttacgttgttatggttcttgcatgcattatttatcatgctgaagaaggttgcagggagtagtaacaacgtgcc |
44934689 |
T |
 |
| Q |
245 |
cgtgtgatttgagttagtgggtgctatttactttacaaaaggtt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44934688 |
cgtgtgatttgagttagtgggtgctatttactttacaaaaggtt |
44934645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University