View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16389_low_16 (Length: 291)
Name: NF16389_low_16
Description: NF16389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16389_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 21 - 285
Target Start/End: Original strand, 45409123 - 45409386
Alignment:
| Q |
21 |
agcttaaccatttcaaatgctactaatccaatccgtgattaaggtcccataaacactgtcggtggtagataatagagtgattagccttacacgtgcttaa |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45409123 |
agcttaaccatttcaaatgctaccaatccaatccgtgattaag-tcccataaacactgtcggtggtagataatagagtgattagccttacacgtgcttaa |
45409221 |
T |
 |
| Q |
121 |
tagtttagacagagcttccctttgctcacctctttaacaacctctacttagcnnnnnnnnnnnnnnnnnnaatcatatcatagatctagattcatttcgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45409222 |
tagtttagacagagcttccctttgctcacctctttaacaacctctacttagctttttatttttattttttaatcatatcatagatctagattcatttcgt |
45409321 |
T |
 |
| Q |
221 |
gtctattgtcttaaatttcaaactacccctgaaattacttttggacaattataaattcatctcac |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45409322 |
gtctattgtcttaaatttcaaactacccctgaaattacttttggacaattataaattcatatcac |
45409386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University