View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1638_low_10 (Length: 293)
Name: NF1638_low_10
Description: NF1638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1638_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 23 - 258
Target Start/End: Original strand, 45271255 - 45271490
Alignment:
| Q |
23 |
agagttgtagttcttttgaatgctggttaagtcatgaagcagttcacttttcaatctaattttttgcatttctaggcattacttgatgatatannnnnnn |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45271255 |
agagttgtagttcttttgaatgctggttaagtcatgaagcagttcacttttcaatctaattttttgcatttctaggcattacttgatgatatattttttt |
45271354 |
T |
|
| Q |
123 |
nnnaatgaattgttaaacatcttcgcctaatatcaaccccttgagtattgttttagtcttagttttgtagttttttatgattaaaataataattggtcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45271355 |
tttaatgaattgttaaacatcttcgcctaatatcaaccccttgagtattgttttagtcttagttttgtagttttttatgattaaaataataattggtcat |
45271454 |
T |
|
| Q |
223 |
accctcttgcaatgcaactgtatttgtttcttcctc |
258 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45271455 |
acactcttgcaatgcaactgtatttgtttcttcctc |
45271490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 170 - 232
Target Start/End: Original strand, 16874945 - 16875007
Alignment:
| Q |
170 |
ttgttttagtcttagttttgtagttttttatgattaaaataataattggtcataccctcttgc |
232 |
Q |
| |
|
|||||||| |||| ||||||||||| ||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
16874945 |
ttgttttaatctttgttttgtagttatttatgattaaaataataattggtcatccactcttgc |
16875007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University