View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1638_low_13 (Length: 249)
Name: NF1638_low_13
Description: NF1638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1638_low_13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 6435710 - 6435478
Alignment:
| Q |
17 |
tcaaattttgagcttttatatttctgcaagtcttttctacaaataacaatgtaaactccgcttaaataaatttcactctgttgtttttcttttgttaaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6435710 |
tcaaattttgagcttttatatttctgcaagtcttttctacaaataacaatgtatactccgcttaaataaatttcactctgttgtttttcttttgttaaca |
6435611 |
T |
|
| Q |
117 |
agattagcaagagaaaacaagcacatggcagacagtggtgcaaaagtcacaattgttgatactatggtgcttctctttttaacctgtgctgacagtatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6435610 |
agattagcaagagaaaacaagcacatggcagacagtggtgcaaaagtcacaaatgttgatactatggtgcttctctttttaacctgtgctaccagtatat |
6435511 |
T |
|
| Q |
217 |
acaattacatgtgcagaatcagtttttcattgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6435510 |
acaattacatgtgcagaatcagtttttcattgt |
6435478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University