View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1638_low_16 (Length: 223)
Name: NF1638_low_16
Description: NF1638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1638_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 39824524 - 39824728
Alignment:
| Q |
1 |
tctatggtgagattgttatgagcatttgaataaacttgttctactagcattttacaggtaccggttttcactgcacgatttgtgagggctctaaggaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824524 |
tctatggtgagattgttatgagcatttgaataaacttgttctactagcattttacaggtaccggttttcactgcacgatttgtgagggctctaaggaaac |
39824623 |
T |
|
| Q |
101 |
tataagctaagcgttgatttgaatcaccgtcttgtggtgctatgttattgagaacccaaaggatttgttgagcaagtgttacatcgtttgtttcgattgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39824624 |
tataagctaagcgttgatttgaatcaccgtcttgtggtgctatgttattgagaacccaaaggatttgctgagcaagtgttacatcgtttgtttcgattgc |
39824723 |
T |
|
| Q |
201 |
gtttg |
205 |
Q |
| |
|
||||| |
|
|
| T |
39824724 |
gtttg |
39824728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University