View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1639-INSERTION-3 (Length: 351)
Name: NF1639-INSERTION-3
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1639-INSERTION-3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 351
Target Start/End: Original strand, 42274111 - 42274454
Alignment:
| Q |
9 |
tatctattgatggaaattcgtgtgaactgaattttttgcttcaattgattgattgtattaaaagtaggtt-ttaggtaggaaaagnnnnnnnnnnnnnnn |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
42274111 |
tatctattgatggaaattcgtgtgagctggattttttgtttcaattgattgattgtattaaaagtaggttgttaggttggaaaagttttttttttttttt |
42274210 |
T |
|
| Q |
108 |
ngacaaaaagttggaaaagttgtaatctttcatcgggg-tcgtataattcttttgaaatatgttatgtcatgtcatttacaccggtctacgttctttcct |
206 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42274211 |
tgacaaaaggttggaaaagttgtaatctttcatcgggggtcgtatgattcttttgaaatatgttatgtcatgtcatttataccggtctacgttctttcct |
42274310 |
T |
|
| Q |
207 |
tcttcaagactcctatagataccatctcttctatggaatctactttaaaagnnnnnnnaggaaaattgcatggttaaaatgagatacaatttgtttgaaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
42274311 |
tcttcaagactcctatagataccatctcttctatggaatctattttaaaagtttttttaggaaaattccatagttaaaatgagatacaatttgtttgaaa |
42274410 |
T |
|
| Q |
307 |
ggggaaaagggtggattaggggttagaaggtgggtttgtttgttt |
351 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42274411 |
-gggaaaatggtggattaggggttagaaggtgggtctgtttgttt |
42274454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 248
Target Start/End: Complemental strand, 16479012 - 16478952
Alignment:
| Q |
188 |
ccggtctacgttctttccttcttcaagactcctatagataccatctcttctatggaatcta |
248 |
Q |
| |
|
||||| ||| ||||||||||||||||| | |||| || || |||||||||||| ||||||| |
|
|
| T |
16479012 |
ccggtttactttctttccttcttcaaggcccctacaggtatcatctcttctatcgaatcta |
16478952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 256
Target Start/End: Original strand, 18488389 - 18488457
Alignment:
| Q |
188 |
ccggtctacgttctttccttcttcaagactcctatagataccatctcttctatggaatctactttaaaa |
256 |
Q |
| |
|
||||| ||| ||||||||||||||||| | |||| || || |||||| ||||| ||||||| ||||||| |
|
|
| T |
18488389 |
ccggtttactttctttccttcttcaaggcccctacaggtatcatctcctctatcgaatctattttaaaa |
18488457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 248
Target Start/End: Original strand, 21823898 - 21823958
Alignment:
| Q |
188 |
ccggtctacgttctttccttcttcaagactcctatagataccatctcttctatggaatcta |
248 |
Q |
| |
|
||||| ||| ||||||||||||||||| | |||| || || |||||||||||| ||||||| |
|
|
| T |
21823898 |
ccggtttactttctttccttcttcaaggcccctacaggtatcatctcttctatcgaatcta |
21823958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University