View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1639-INSERTION-4 (Length: 158)
Name: NF1639-INSERTION-4
Description: NF1639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1639-INSERTION-4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 5e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 5e-82
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 2833593 - 2833750
Alignment:
| Q |
1 |
ccctaacccatccctagcttaacccgataatttatgcctcatgttggactggatttaagacaaaatcgagttggcttgaaatacatttacaacgttttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833593 |
ccctaacccatccctagcttaacccgataatttatgcctcatgttggactggatttaagacaaaatcgagttggcttgaaatacatttacaacgttttta |
2833692 |
T |
 |
| Q |
101 |
atgactttactacacacacatccctaataaatctcattttataagtcattaaaatcca |
158 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833693 |
atgactttgctacacacacatccctaataaatctcattttataagtcattaaaatcca |
2833750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University