View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16390_high_4 (Length: 328)
Name: NF16390_high_4
Description: NF16390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16390_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 42003545 - 42003219
Alignment:
| Q |
1 |
aattcttctctggttgaaaatgaaaagatgttctctgccacgacaacatagtattgttccatggaaatgattcagtttctccaaccttattggccccgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42003545 |
aattcttctctggttgaaaatgaaaagatgttctctgccacgacaacatagtattgttccatggaaatgattcagtttctccaaccttattgggcccgga |
42003446 |
T |
|
| Q |
101 |
gagaaaaacatttgacttctccgacacaccagctgaaacacttggtgaaacaaccatgtttggttttgtttcttcatgggataaaatcgaagatgacgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003445 |
gagaaaaacatttgacttctccgacacaccagctgaaacacttggtgaaacaaccatgtttggttttgtttcttcatgggataaaatcgaagatgacgag |
42003346 |
T |
|
| Q |
201 |
gagacgtgagcatgagggacactaacgttgtcggaagctttgtagccactaaaggctattagagaagcaagtaaaaacaatccacaaaaaatgagaagaa |
300 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003345 |
gacacgtgagcatgagggacactaacgttgtcggaagctttgtagccactgaaggctattagagaagcaagtaaaaacaatccacaaaaaatgagaagaa |
42003246 |
T |
|
| Q |
301 |
gctccttacgattgttattgtggggcc |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42003245 |
gctccttacgattgttattgtggggcc |
42003219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University