View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16391_high_11 (Length: 329)
Name: NF16391_high_11
Description: NF16391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16391_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 3 - 76
Target Start/End: Complemental strand, 41469370 - 41469297
Alignment:
| Q |
3 |
attaaaaataaataaatatcataaaatcaactcaaaagaaattgcaacacaaatagctagtactatgaattaag |
76 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41469370 |
attaaaaataaataaatatcataaaatgaactcaaaagaaattgcaacacaaatagctagtactatgaattaag |
41469297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 16410207 - 16410249
Alignment:
| Q |
20 |
atcataaaatcaactcaaaagaaattgcaacacaaatagctag |
62 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
16410207 |
atcataaaatcaactccaaagaaattgctacacaaatagctag |
16410249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 239
Target Start/End: Complemental strand, 3678358 - 3678326
Alignment:
| Q |
207 |
taaaaattaatttaacaactaattgctaacatt |
239 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
3678358 |
taaatattaatttaacaactaattgctaacatt |
3678326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University