View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16391_low_11 (Length: 329)

Name: NF16391_low_11
Description: NF16391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16391_low_11
NF16391_low_11
[»] chr2 (1 HSPs)
chr2 (3-76)||(41469297-41469370)
[»] chr4 (2 HSPs)
chr4 (20-62)||(16410207-16410249)
chr4 (207-239)||(3678326-3678358)


Alignment Details
Target: chr2 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 3 - 76
Target Start/End: Complemental strand, 41469370 - 41469297
Alignment:
3 attaaaaataaataaatatcataaaatcaactcaaaagaaattgcaacacaaatagctagtactatgaattaag 76  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
41469370 attaaaaataaataaatatcataaaatgaactcaaaagaaattgcaacacaaatagctagtactatgaattaag 41469297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 16410207 - 16410249
Alignment:
20 atcataaaatcaactcaaaagaaattgcaacacaaatagctag 62  Q
    |||||||||||||||| ||||||||||| ||||||||||||||    
16410207 atcataaaatcaactccaaagaaattgctacacaaatagctag 16410249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 239
Target Start/End: Complemental strand, 3678358 - 3678326
Alignment:
207 taaaaattaatttaacaactaattgctaacatt 239  Q
    |||| ||||||||||||||||||||||||||||    
3678358 taaatattaatttaacaactaattgctaacatt 3678326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University