View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16391_low_13 (Length: 326)
Name: NF16391_low_13
Description: NF16391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16391_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 19 - 314
Target Start/End: Complemental strand, 42393100 - 42392805
Alignment:
| Q |
19 |
actatattcactcttcatattacaatatagggtaattgatagggagggaaagtgtcgtgtgtattctatgattgttgatgcttgaaaattgttcaaaact |
118 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393100 |
actatattcactattcatattaccatatagggtaattgatagggagggaaagtgtcgtgtgtattctatgattgttgatgcttgaaaattgttcaaaact |
42393001 |
T |
|
| Q |
119 |
tcaatattgttaagaatagcaattcaatgagcttctacttacggagagcaccatttatcattgctggagtttttaacaattttcaagtatttgtctgaca |
218 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
42393000 |
tcaatgttgttaagaatagcaattcaacgagcttctacttacggagagcaccattgatcattgctagagtttttaacaattttcaagtatttgtctaaca |
42392901 |
T |
|
| Q |
219 |
tacaccatatgagacacttctctaccctagaaaccacctatcatatgaatattgatcaagggaatctagattcagcactcaatgctagtataatct |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42392900 |
tacaccatatgagacacttctctaccctagaaaccacctatcatatgaatattgatcaagggaatctagattcagcgctcaatgctagtataatct |
42392805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 75 - 123
Target Start/End: Complemental strand, 42376496 - 42376447
Alignment:
| Q |
75 |
gtgtgtattctatgattgttgatgcttg-aaaattgttcaaaacttcaat |
123 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42376496 |
gtgtgtattctacgattgttgatgcttgtaaaattgttcaaaacttcaat |
42376447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University