View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16391_low_23 (Length: 205)

Name: NF16391_low_23
Description: NF16391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16391_low_23
NF16391_low_23
[»] chr6 (1 HSPs)
chr6 (15-89)||(29474613-29474689)


Alignment Details
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 15 - 89
Target Start/End: Complemental strand, 29474689 - 29474613
Alignment:
15 aatatggagttttcagtttatttctggcttctaagaaagtttcccatg--atagtctgtattatggtggaggacaaa 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |  |||||||||||| ||||||||||||||    
29474689 aatatggagttttcagtttatttctggcttctaagaaagtttcccaagatatagtctgtattgtggtggaggacaaa 29474613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University