View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16391_low_23 (Length: 205)
Name: NF16391_low_23
Description: NF16391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16391_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 15 - 89
Target Start/End: Complemental strand, 29474689 - 29474613
Alignment:
| Q |
15 |
aatatggagttttcagtttatttctggcttctaagaaagtttcccatg--atagtctgtattatggtggaggacaaa |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
29474689 |
aatatggagttttcagtttatttctggcttctaagaaagtttcccaagatatagtctgtattgtggtggaggacaaa |
29474613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University