View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16392_low_13 (Length: 351)
Name: NF16392_low_13
Description: NF16392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16392_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 17 - 343
Target Start/End: Complemental strand, 32866931 - 32866605
Alignment:
| Q |
17 |
gaatatatcttcgaaaaggacaaaagataaagatacttgttcttagggaattccctatatgaatcaggaaagtggacaacaagtggaagatgggaatcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32866931 |
gaatatatcttcgaaaaggacaaaagataaagatacttgttcttagggaattccctatatgaatcaggaaagtggacaacaagtggaagatgggaatcaa |
32866832 |
T |
 |
| Q |
117 |
gatcaaattagggacatgccttttattgttctaaaatcaaagatactttcttcattttttccattggcaacttggacttctctttttagatactaagtca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32866831 |
gatcaaattagggacatgccttttattgttctaaaatcaaagatactttcttcattttttccattggcaacttggacttctctttttagatactaagtca |
32866732 |
T |
 |
| Q |
217 |
gtggattacagtgtcaaaatattcaacatgcaatgccagacctgaagatagtttgaatattatcttttattttcaacgagtggtcctataggttggtgcc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32866731 |
gtggattacagtgtcaaaatattcaacatgcaatgccagacctggagatagtttgaatattatcttttattttcaacgagtggtcctataggttggtgcc |
32866632 |
T |
 |
| Q |
317 |
tacgtgccctcatcgcatcttcatgtc |
343 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32866631 |
tacgtgccctcatcgcatcttcatgtc |
32866605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University