View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16393_high_1 (Length: 474)
Name: NF16393_high_1
Description: NF16393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16393_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 3003244 - 3003545
Alignment:
| Q |
1 |
tgaatttgttggctctgctagggcttccctagggaaaccctgaatctctctttcttcatggccgacttctcaatttttgaacgaaatggtgttgaacatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3003244 |
tgaatttgttggctctgctagggcttccctagggaaaccct----ctctctttcttcatggccgacttctcaatttttgaacgaaatggtgttgaacatc |
3003339 |
T |
|
| Q |
101 |
cttatattggaaaccattcatgttcgtcggtggtggcaaaactttgaatggtctaatataaatcgaataaggttgatgcacttagtttagattcggtgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3003340 |
cttatattggaaaccattcatgttcgtcggtggtggcaaaactttgaatggtctaatataaatcgaataaggttgatgcacttagtttagattcggtgtt |
3003439 |
T |
|
| Q |
201 |
tcatggcttggtatattttttgtaatcaattgataaaattcactatgtggtttcatgatgatcactaggcggaatgttgccctcaaactttcaaatagta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3003440 |
tcatggcttggtatattttttgtaatcaattgataaaacttactatgtggtttcatgatgatcattaggcggaatgttgccctcaaactttcaaatagta |
3003539 |
T |
|
| Q |
301 |
caagaa |
306 |
Q |
| |
|
|||||| |
|
|
| T |
3003540 |
caagaa |
3003545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 299 - 331
Target Start/End: Original strand, 3003574 - 3003606
Alignment:
| Q |
299 |
tacaagaatgcaacgacattattttcgagcaac |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3003574 |
tacaagaatgcaacgacattattttcgagcaac |
3003606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University