View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16393_low_4 (Length: 343)
Name: NF16393_low_4
Description: NF16393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16393_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 13 - 287
Target Start/End: Original strand, 43369369 - 43369640
Alignment:
| Q |
13 |
aatatgacataagagatagatctttaagttctttaattatttgatttagagtttgnnnnnnntgccaactactttgaagaacttagtttttaaaattgtg |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43369369 |
aatatgacatgagagatagatctttaagttctttaattatttgatttagagtttgaaaaaa-tgccaactactttgaagaacttagtttttaaaattgtg |
43369467 |
T |
 |
| Q |
113 |
aagagtatcctttgtatataaaaaatgtgtacatgttannnnnnnnnnnnnnnnagtgcatgttcttgatacatcctttcatttttatcgtcacgttgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43369468 |
aagagtatcctttgtatataaaaaatgtgtacatgtta-tttttttatttttttagtgcatgttcttgatacatcctttcatttttatcgtcacgttgaa |
43369566 |
T |
 |
| Q |
213 |
atgnnnnnnntgggaagatatgtaaccacgaagggggacatgaagcaagctaagaatgagtggaagagttctttc |
287 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43369567 |
atg-aaaaaatgggaagatatgtaaccacgaagggggacatcaagcaagctaagaatgagtggaagagttctttc |
43369640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University